Final Paper Essay Example | Topics and Well Written Essays - 1500 words - 1

Final Paper - Essay Example Those who wanted to purchase homes in black neighborhoods were not covered in their mortgage even if they were financially well-off. As a result, black families and communities became trapped in these poor communities and their plight was not improved at all when other white communities were flourishing. Part of the development process in the cities also included the building of freeways cutting through many black communities and areas, prompting these people to move and settle in the suburbs or in other more convenient areas. The devastating part about the building of the freeway system is that it only cut through the black and poorer communities, but hardly through rich and white neighborhoods. This practice successfully separated black and white communities, or poor and rich communities – it successfully displaced the already disadvantaged black communities into poorer and even more dangerous neighborhoods. The government also provided much motivation for the middle class whites to leave the cities and flee to the suburbs. Motivation came in the form of mortgage and tax exemptions offered to veterans. Consequently, these individuals took advantage of these benefits and further increased the gap between the rich and the poor and increasing the concentration of poverty in some areas. These suburban communities featured successful individuals – most of them were white. In fact, the first black family to settle in such an urban community was bullied and eventually driven out of the community. In effect, the rich and the white status of said communities were maintained and the black and poor image of the urban poor was also maintained. Moreover, zoning policies further restricted the access of the poorer people to the more affluent and more progressive urban communities. New housing policies which were set forth in the aftermath of the

Organisational Change Management Essay Example | Topics and Well Written Essays - 2750 words

Organisational Change Management - Essay Example However, as a result of improved technology large number of employees has lost their jobs thus resulting to low household incomes and reduced purchasing power (Thompson and Strickland, 1987). It is important to note that while managers are focused at making changes that will improve the productivity of their firms, employees are not always supporting the changes. Thus, it is the duty of the managers to ensure that their employees are aware of the changes and that they are well informed of the implications of the changes in their organization. This paper critically evaluates the implications of changes that have occurred in D2. Definition D2 is a car manufacturing company based in France. In its effort to attain a high level of profitability, the company has embarked on product innovation, expanding its investment as well as improving the performance of its employees. Changes in economic environment that were as a result of recent economic downturn are major causes of adjustments in t he demand for the company products. Despite the competitive position that the company has achieved, it is struggling to survive. It is on this bases that the company executive board has embarked on an urgent change in its operations. Another notable aspect that makes the company to initiate change is to reduce costs of operations. According to Cooperrider and Dan (2001), high costs of production as well as increased marketing expenses are major causes of reduction in profit. In this regard, companies that are focused at minimizing their costs must make initiatives to change their mode of operations. The need for expanding the production capacity is another key issue that has influenced changes in D2. Despite efforts by managers to ensure that the top management team is aware of the changes, some senior managers have not been informed about the new developments. This may cause resistance since those managers have not been involved in the processes (Weiner, 2000). Taking into consider ation the changes in the Didcot branch, employee’s resistance may also be experienced once the plant is closed. As depicted by the executive board, the closure of Didcot will result to loss of employment for majority of the employees working in the plant. Similarly, there will be less chances of redeploying the employees to other branches in Spain and France. Considering their significant contribution to the company and their efforts to meet the corporate objectives, managers and other employees in the Didcot plant will trigger resistance that may jeopardize the operations of the company (Bramble, 1996). One of the key strategies that the company has adopted in order to attract and maintain customers is product development. Based on the need to relocate its production engineers from Didcot to Blois, the company will also experience a resistance from the engineers who will be reluctant to emulate the change. However, this will not be experienced for a long time since the compa ny has taken initiatives to employ its production engineers thus creating a feeling of job security among the workers. Discovery Changes within an organization such as D2 can be effected in the areas of technology, business location and management among others. My choice for resistance to change is based on the significant negative implications that it can bring to a firm if not effectively addressed by the management team. Based on

Oil Extraction Essay Example for Free

Oil Extraction Essay When extracting lipids or fats from foods, both the method as well as the solvents chosen to perform a complete, or close to complete extraction are important. If these two elements are not taken into consideration, the extraction may not be complete, or the extract may contain a large quantity of undesired impurities. The natural fats and oil are mixtures of glycerides of fatty acids. Fats and oils are naturally occurring organic compounds which belong to a large group of water insoluble substances called lipids. Lipids are relatively non-polar molecules, they can be pulled out of a sample using relatively non-polar solvents. With a non-polar solvent, only non-polar molecules in the sample dissolve while polar ones do not. A solution to the problem of extracting trapped lipids is to use an extraction procedure such as the soxhlet that will help break up the polar barriers and allow the solvent to reach the non-polar compounds and extract them. In this experiment, soxhlet extraction was used. Soxhlet extraction is an extraction method that uses chemical solvents. Oils from the algae are extracted through repeated washing, or percolation, with an organic solvent such as hexane or petroleum ether, under reflux in a special glassware. Copra, dried kernel of the coconut, was the sample used. Often though, the sample must be ground and prepared prior to the extraction procedure in order to break up the cell membranes and other structures that would make extraction difficult. In this experiment, petroleum ether was used as the solvent due to its low boiling point, relatively non-toxic nature (when compared to chloroform or methanol), and of course because it is quite non-polar. When talking about ether, two kinds can be used in lipid extraction: anhydrous diethyl ether CH3CH2OCH2CH3 and petroleum ether, which is a mixture of pentane (CH3CH2CH2CH2CH3) and hexane (CH3CH2CH2CH2CH2CH3). Petroleum ether is more non-polar, cheaper and less flammable than diethyl ether. Due to its greater non-polarity, petroleum ether will yield a more specific extract than diethyl ether because it will only extract the most polar molecules. However, as petroleum ether may not be able to break apart some of the more polar shells surrounding some lipids and give a near complete lipid extraction, diethyl ether is usually used despite its higher flammability and cost.

Exploring The Health Benefits Of Tea

Exploring The Health Benefits Of Tea Japan the country with the worlds longest life expectancy. Based on Paul Wiseman, journalist from USA TODAY reported that Japanese live longer life compared to everyone else in the world (par. 1). Frank Jordans, journalist of The Huffington Post also states that Japanese girls that are born in the year 2009 have a high chance of living to the year 2095, some may even stand the chance to explore the wonders of the next century (par. 1). Have you ever question the reason why Japanese carries the title of the worlds longest life expectancy? One of the reason is Japanese consume tea, in large quantity. Many countries across the globe believed in the health benefits of drinking tea peculiarly China, Japan, India and even England. Tea, commonly known as the natures wonder drug should be continuously explored by the general public to increase health awareness (Tea Benefits). The natures wonder drug tea, plays an important role in varies countries around the world which includes the formation of cultural ceremonies, trade routes, formal events, entertainment, and leisure for almost 4000 years. Tea is important not just solely due to the taste but also the health benefits that are tied along this ancient drink. Hence, people should include tea into their daily routine and experience the revitalizing benefits of tea (Walker). Tea has numerous health benefits that could be grouped into 5 different categories: overall health care, mental health, internal organ, fitness appearance, and illness disease. Tea contains chemicals known as polyphenols that provides antioxidant properties of tea. Antioxidant reduces the rate of aging process and improves regeneration of cells (Bell). It is true that coffee also contains antioxidant properties that have similar effect towards our human body, but, coffee contains much more caffeine as compared to tea that contributes towards a negative effect on human. For every ounces of green tea, it contains 3.1mg of caffeine while every ounce of a Starbucks Tall Coffee contains 21.7mg of caffeine (Energy Fiend). In this case, the caffeine level in coffee is 7 times stronger compared to tea. Just like any drugs, caffeine causes a chemical reaction that creates addiction towards the brain that will cause withdrawal symptoms when caffeine is not taken. When temporary stimulation is not given, brain cells will start demand for caffeine for stimulation. Deprivation of caffeine might even result in severe conditions like depression or other mental problem (Jo hnson). In addition, tea helps to keep body hydrated. Most caffeinated drinks actually dehydrate body fluid unless more than five to six cups are consumed at a time but tea has the opposite reaction. Tea is shown to be healthier than water as it keeps body hydrated in the same time providing antioxidants and a moderate amount of caffeine that is suitable for body intake (Walker). Many researches also show that tea provides a positive impact towards the brain and improve mental state of a person. Tea contains amino acid L-theanine that is scientifically proven to improve relaxation and concentration (Walker). I understand that many people like to drink coffee at it provides similar effects, some may even argue that coffee is better than tea as it provide instantaneous and stronger boost towards the brain as it contains a much higher level of caffeine. However, when high dosage of caffeine is consumed to provide the mental stimulant, it will lead to depression, mood swing and nervousness in the long run (Rodolfo). Tea also decreases the probability of having cognitive impairment, which affects the ability to think, reason, formulate ideas, and remember. Research shows that Japanese adults who drink at least 2 cups of green tea daily decrease the risk of cognitive impairment by 50%. Stress is unavoidable across age, gender, nationality and culture. Cortisol, a s tress hormone shows a 20% drop as a result of drinking 4 cups of tea daily for one month. This evidently proves that tea have the effect of reduce stress hormone level (Walker). Long term consumption of coffee in a daily basis will also disturb a persons sleeping pattern. Coffee, a beverage with high level of caffeine is a chemical stimulant that will stimulate our brain to be awake for a longer time period than normal people. This also means that people that consume coffee actually have a shorter sleeping period, and the quality sleep is highly affected. As caffeine is an addictive chemical, it will affect sleeping pattern of a person, and possibly causes insomnia or other sleeping problems, creating feeling of restlessness, tremors, and etc. The level of negative effects varies accordingly based on the consumption period, and consumption quantity (Johnson). Japan to be title the worlds longest life expectancy is mainly due to the fact that tea has many beneficial effects related to our internal organ, mainly our heart. Firstly, tea reduces the risk of heart attack and stroke as it prevents dangerous blood clots which is the main cause of heart attack and stroke. The Boston Area Health Study recorded a 44% lower risk when a person consume at least one cup of tea daily compared to a person that doesnt drink tea (McKay, and Blumberg 3). Not just in Boston, In a long-term study of a Dutch cohort, the highest tertile of tea consumption was associated with a lower risk of death from coronary heart disease and lower incidence of stroke (Yang, and Landau 2410). A reader might ask, is coffee good for our heart as well? Joseph A. Vita from Evans Department of Medicine and Whitaker Cardiovascular Institute, Boston University School of Medicine states that There was no significant relationship between coffee consumption and cardiovascular disease ( 3293S). Hence, this proves that there is no significant positive correlation between coffees as compared with the natures wonder drug tea. On the other hand, tea helps lessen blood pressure level in the body and decrease risk of hypertension. Drinking half a cup of green tea daily could reduce blood pressure risk by up to half and it has a directly proportional relationship between tea consumption and reduction of blood pressure risk. The more tea is consumed daily, the further reduction of blood pressure risk. A research was held in Taiwan with 1507 subjects to test the long term effect of tea upon hypertension and it was concluded that consumption of more than 120ml or more per day for one year significantly decrease the risk of hypertension in the Chinese population (Yi-Ching Yang et al. 1534). Using this research as the fundamental base of argument, consumption of tea in a large quantity will further provide benefits towards our heart, hence, tea should be included into our daily routine. Teas benefits are not just limited to our heart and blood pressure, it also proven to improve our digestive system. For the past 5000 years, tea has been widely used in China as an after-meal drink to aid digestion as it contains high level of tannins. Other than that, polyphenols in green tea presented an effect that helps intestinal inflammation while antispasmodic agent available in the properties of red tea helps to relief stomach cramp (Walker). On the other hand, using coffee as a comparison, drinking coffee with an empty stomach will harm our internal body which will leads to ulcer growth in the long run (Rodolfo). As a people slowly include tea into their daily routine, they will discover tea can not only improve mentally brain, physically internal organs but also providing effects on a persons fitness and appearance as well. Most people does not know that tea contains tannins and fluoride, substance that is contain in regular toothpaste, in which both reduce oral tooth decay and plaque. University of Chicago proposed polyphenols that is contain in tea aids bad breath. Hence, tea provides a platform for oral care that includes healthier teeth and breath issues that is suffered by people. Antioxidant in green tea also take place in acne problems, it was shown to be functioning the same as 4% benzoyl peroxide which is mainly used in acne treatment, bleaching teeth and hair and improving flour (Walker). Hence, why not get acne-free skin from natural antioxidant by drinking tea? A cup of tea with its full aroma has no calories unless sweeteners, sugar or milk is added. This beverage is one of the healthiest low calorie drinks that provide the morning boost without worrying of gaining weight (Walker). It is true that coffee itself is also calorie free, but, most coffee drinkers have the habit of adding sugar, creamer, sweeter or milk into their coffee compared to tea drinkers, using the research held in Taiwan, out of 1507 subjects, only 4.8% have the habit of adding milk into their beverage tea (Yi-Ching Yang et al. 1537). It was also found out by the department of chemical biology of the State University of New Jersey that feeding oolong tea to diet-induced obese mice for 10 weeks prevented obesity and fatty liver (Yang, and Landau 2411). In addition, consumption of coffee (caffeine) in large quantity at once will also disrupt sugar level in blood that could affect fat burning to change into storing fat which will cause it weight gain and other negative ef fects towards out body (Wash). Since tea has so many benefits towards our health in regards of mentally nor physically, does tea have any positive implication towards illness and disease as well? The answer is YES. Tea contributes towards strengthening of our body immune defenses system. A study was held among tea drinkers and coffee drinkers to compare immune activity within the body and it was found that immunity activity was up to five times higher in tea drinkers. Hence, practice the habit of drinking tea especially when there are people around you not feeling too well as it could help to prevent germs or virus entering your body. As tea increase our immunity system, tea also aids fighting flu as participants who gargle black tea extract solution twice a day was found to be more immune to flu virus (Walker). Instead of taking flu shots, why not just try the magical effect of tea? Besides, tea contains alkylamine antigens, which is an organic compound similar function as some bacteria and tumor cells to boost immunity. Evidence shown that tea even has effect on serious infections like sepsis, a severe bacterial infection in body tissue or blood stream. Likewise, tea also has effect in preventing food poisoning. Bacteria which lead to food poisoning are killed and toxins effects are minimize through a substance known as catechin, a bitter ingredient in green tea. With the combination of catechin and polysaccharides, it was also found to have an effect on lowering blood sugar, which will also, leads to diabetes prevention in the long run (Walker). It is true that coffee prevents type 2 diabetes, it is a beverage that naturally contains sugar that are sugar friendly to our blood, if no additional substance (sugar, creamer, syrup, and etc.) are added, it is no doubt coffee is beneficial for controlling sugar level when consumed in small quantity. Based on the World Health Organization statistics, cancer the leading cause of death with 13% worldwide, accounted for 7.9 million people in 2007. The bad news is that deaths caused by cancer are projected with an uphill slope of up to 12 million deaths in 2030. The good news is, about 30% of the death caused by cancer can be prevented (Cancer). Tea, offers a gateway toward the prevention of cancer. Many experiments and research are held to question the relationship between tea and prevention of cancer development. Studies held in Asia among 8552 Japanese adults for nine years, all subjects consume at least 10 cups of green daily are found to be having the effect of delaying cancer onset. The protective effect differs according with gender females by 8.7 years while male by three years when compared to subjects consume less than 3 cups a day. On the contrary, the delay effect of cancer was found to be less significant in Europe populations who generally consume black tea. Therefore it is important to understand the effects of different tea on our body as well as the effect of tea also differ on type of cancer (McKay, and Blumberg 6). For instance, no relation was found between tea and breast cancer in recent studies in United States, Netherlands and Italy. Conversely, 472 Japanese patient with stage I and II breast cancer recorded an inverse relationship between green tea consumption period and recurrence rate after seven years. Green tea contains substances that able modifies sex hormones that have major relationship with the risk of breast cancer reoccurrence (McKay, and Blumberg 6). Another study that was held in Iowa in regards of postmenopausal woman, it was shown that there are lower risk for urinary tract cancer and digestive tract cancer when black tea is consumed (Yang, Landau 2411). Besides that, in Netherlands, 120852 people were observed to have a weak, inverse association with consumption of black tea and stomach cancer. However, in Poland, a significant result of stomach cancer reduction is found in woman who drank tea daily. Although the effect does not occur to men, it is important to take note th at growth of stomach cancer cells are inhibited through theaflavins, a substance contain in black tea (McKay, and Blumberg 6). The most important point is to acknowledge the different tea has its own unique chemical substances and effects towards human body in the same time understanding that there is no one tea fit all concept. The effects of tea vary accordingly and it is high affected by lifestyle, eating habit, geographical, population and climate of an individual. A careful in dept study should be held in each nation to understand the chemical properties of tea in associate with lifestyle from that area itself to obtain its greatest potential benefits. In the nut shell, tea has a vast variety of benefits which includes taking care of our overall health care and mental health, protecting our internal organs, in the same time provides a better fitness and appearance. It also provides preventive measures for illness and disease. Hence, the next time anyone asks the question, Hello, would you like coffee or tea? Please reply, I would like TEA.

Immune System of a Plant

Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà ­a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164  µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10  µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65 °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20  µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65 °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37 °C and resuspended in sterile deionized water for a final volume of 500  µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20  µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200  µM dNTPs, 0.2  µM forward primer, 0.2  µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1  µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ã…Â az ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin

the gold fields of Victoria :: essays research papers

Victoria was a part of the colony of New South Wales up to the early 1850's, when it became an independent colony in its own right. All burgeoning States have growing pains and Victoria was no exception. Rich in agricultural lands early settlers took out sheep runs granted by the government over large tracts of land, where both sheep and some cattle were grazed. Van Diemen's Land to the south, now the State of Tasmania had large penal settlements and the government bureaucracy was both well established and manned. Victoria drew on these reserves in the early years of settlement. The wealth of gold hidden in Central Victoria lay undiscovered for some time and true recognition of the potential was not realized until the finds were widely publicized. Ballarat is an aboriginal name meaning "a good place to rest". An aboriginal tribe known as the Kulin inhabited the area. These inhabitants had dark brown skin rather than black. Although they were the traditional owners of the land, they were simply pushed aside by European settlement, and decimated by disease, poisoning, shootings and in fact genocide. Within 60 years they were no more. The first recorded gold finds in the district was at Clunes, July 1851, some 20 miles north of Ballarat, and this started a small rush. A few weeks later gold was found at Buninyong about 10 miles south of Ballarat. This was poor yielding ground and although diggers came to the area, they quickly dispersed seeking more profitable ground. Two such characters were John Dunlop, a seventy-year-old veteran of the Battle of Waterloo, and a much younger James Regan, whose ancestry was Irish. They had been disappointed with the gold at Buninyong, so decided to prospect the area themselves in anticipation that both Clunes and Buninyong would not be the only gold bearing ground in the district. They were right and after finding gold in creek beds along the White Horse Range on Ballarat Station, they came to a small hill on the northern end of the range and washed the first gold from what was to become one of the great gold bonanza's of all time. The date was 21st August 1851. This hill became known as Poverty Point. (Only because the top of the hill contained no gold) The discovery only remained a secret for about a week, and with news of the gold find the first great gold rush of Victoria had begun.

Englishmen 17th century :: essays research papers

FIRST ESSAY: Thomas Hobbes described the life of most Englishmen in the 17th century as â€Å"nasty, brutish and short.† How far does the evidence presented in Past Speaks chpt. 2, suggest that little had changed by the mid 18th century?   Ã‚  Ã‚  Ã‚  Ã‚  Chapter two of Past Speaks, covers many different articles that discusses the many social classes that were present in Britain at that time. When Thomas Hobbes described the life of the Englishmen as â€Å"nasty, brutish and short.† he was partially correct. On the contrary he was also mistaken. Thomas Hobbes made a generalization of the Englishmen, and failed to mention some of the upper and profitable people of the British society. Obviously the wealthy and prosperous people were not included in this generalization that is made. Farmers from Norfolk were very successful, as stated in Past Speaks chapter 2, â€Å"Pointing out the practices which have succeeded so nobly here, may perhaps be of some use to other countries possessed of the same advantages, but unknowing in the art of them.† Arthur Young, a traveling one-man bureau, wrote about these farmers and successful cattle-breeding men. He speaks of a man by the name of Robert Bakewell, who turne d out to be a very wealthy man. Bakewell experimented in the breeding of cattle. He managed to breed a large amount of cattle that could produce more meat and less bone, in which he ended up shipping overseas to neighboring countries. Thomas Hobbes again, did not include these men in the comment he had made.   Ã‚  Ã‚  Ã‚  Ã‚  Henri Misson, visiting sportsmen to England did write on the sports and diversions of England. Misson writes â€Å"Anything that looks like fighting is delicious to an Englishman. If two little boys quarrel in the street, then passengers stop, make a ring round them in a moment, and set them against one another, that they may come to fisticuffs.† This piece does support Thomas Hobbes comment on the difference of Englishmen from the 17th to the 18th century. This seemed as little or nothing had changed with the society. Another quote from Past Speaks â€Å"these by-standers are not only other boys, porters and rabble, but all sorts of men of fashion; some thrusting by the mob that they may see plain†. This is evidence that not only the lower social class, but the upper class as well were enthused. This is evidence to Hobbes remark.   Ã‚  Ã‚  Ã‚  Ã‚  Thomas Hobbes however did not believe in Democracy.